Sequence ID | >WENV180043320 |
Genome ID | LQAH01028726 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 454 |
End posion on genome | 378 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccctgttagT |
tRNA gene sequence |
GGCCCAGTGGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
ttacgtaatt |
Secondary structure (Cloverleaf model) | >WENV180043320 Asp GTC T GTCa ttacgtaatt G - C G + T C - G C - G C - G A - T G - C T G T T T C C C A T G A G + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |