Sequence ID | >WENV180043324 |
Genome ID | LQAH01028934 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 204 |
End posion on genome | 129 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
atctaacatt |
tRNA gene sequence |
GGAGCTATAGCAAAGCTGGTAATGCCCCGGATTGCAAATCCGGTATGCGTTGGTTCGAGT |
Downstream region at tRNA end position |
ctttttaatc |
Secondary structure (Cloverleaf model) | >WENV180043324 Cys GCA t TCCA ctttttaatc G - C G - C A - T G - C C - G T - A A - T T G T C A G C C A C G A A | | + | | G T A A C G G T T G G C G | | | T T G A T G C T A C TATGC C - G C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |