Sequence ID | >WENV180043330 |
Genome ID | LQAH01029423 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 217 |
End posion on genome | 291 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tttcaacagt |
tRNA gene sequence |
GGTCCCATCGTCTAGTGGTTAGGACGCCGGCCTCTCACGCCGGTAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
cttagataat |
Secondary structure (Cloverleaf model) | >WENV180043330 Glu CTC t ACCA cttagataat G - C G + T T - A C - G C - G C - G A - T T A T G G C C C A T G A C | | | | | G G T C T G C C G G G C G + | | | T T T G G A C T A G TAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |