Sequence ID | >WENV180043331 |
Genome ID | LQAH01029703 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 96 |
End posion on genome | 171 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggataaccat |
tRNA gene sequence |
GGGGGTATAGCTCAGTTGGGAGAGCACCTGCTTTGCACGCAGGGGGTCAAGAGTTCGAGT |
Downstream region at tRNA end position |
taacttttct |
Secondary structure (Cloverleaf model) | >WENV180043331 Ala TGC t ACCA taacttttct G - C G - C G + T G - C G + T T - A A - T T G T T T C T C A T G A A | | | | | G T C T C G A A G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |