Sequence ID | >WENV180043339 |
Genome ID | LQAH01032007 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 226 |
End posion on genome | 301 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taatctgtgc |
tRNA gene sequence |
AGGGATGTCGCCAAGTTGGTAAGGCACGTGGTTTTGGTCCACGCATTCGCGGGTTCGAGT |
Downstream region at tRNA end position |
aattcatttc |
Secondary structure (Cloverleaf model) | >WENV180043339 Gln TTG c GCCA aattcatttc A - T G - C G - C G - C A - T T - A G - C T G T C G T C C A T G A C | | + | | G T A C C G G C G G G C G | | | T T G A G G C T A A CATTC C - G G - C T - A G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |