Sequence ID | >WENV180043358 |
Genome ID | LQAH01035797 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 197 |
End posion on genome | 273 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgttctgcgc |
tRNA gene sequence |
GGGCAATTAGCTCAGTTGGATAGAGTGTCAGCCTCCGGAGCTGAAGGTCACAAGTTCGAA |
Downstream region at tRNA end position |
aatatttcaa |
Secondary structure (Cloverleaf model) | >WENV180043358 Arg CCG c GCCA aatatttcaa G - C G - C G - C C - G A - T A - T T - A T A T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | + T T G G A G T A T A G AGGTC T - A C - G A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |