Sequence ID | >WENV180043431 |
Genome ID | LQAI01000012 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 33304 |
End posion on genome | 33227 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaccagatgc |
tRNA gene sequence |
GTCCCCATCGTCTAGCCCGGTCCAGGACACCGGCCTTTCACGCCGGCGACAGGGGTTCGA |
Downstream region at tRNA end position |
cttatatcaa |
Secondary structure (Cloverleaf model) | >WENV180043431 Glu TTC c GCCA cttatatcaa G - C T - A C - G C - G C - G C - G A - T T A T T C C C C A C C G A C | | | | | G C T C T G A G G G G C G + | | | T T G G G A C T C C A A CGAC C - G C - G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |