Sequence ID | >WENV180043434 |
Genome ID | LQAI01000015 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 167418 |
End posion on genome | 167494 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atcgatcgtt |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGATAGAGCAACGGACTTCTAATCCGTAGGCCACAGGTTCGAA |
Downstream region at tRNA end position |
ctgatatcaa |
Secondary structure (Cloverleaf model) | >WENV180043434 Arg TCT t GCCA ctgatatcaa G - C C - G G - C C - G C - G T - A G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A AGGCC A - T C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |