Sequence ID | >WENV180043442 |
Genome ID | LQAI01000021 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 650 |
End posion on genome | 559 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
atcagcttgc |
tRNA gene sequence |
GGAGAAATGGCCGAGTGGCTGAAGGCGCTCGCCTGCTAAGCGAGTATGGGGGGAAACTTC |
Downstream region at tRNA end position |
ctatcaatca |
Secondary structure (Cloverleaf model) | >WENV180043442 Ser GCT c GCCA ctatcaatca G - C G - C A - T G - C A - T A - T A - T T A T C T C T C A T G A G | | | | | G G G C C G G A G A G C G | | | T T C A G G C T G A G TATGGGGGGAAACTTCCATC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |