Sequence ID | >WENV180043518 |
Genome ID | LQAI01000198 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 36 |
End posion on genome | 112 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ctctttcaac |
tRNA gene sequence |
GCGCCCGTGGCTCAGCTGGATAGAGCATTCGGCTACGAACCGAAAGGTCGCACGTTCGAA |
Downstream region at tRNA end position |
ttaagaaata |
Secondary structure (Cloverleaf model) | >WENV180043518 Arg ACG c ACCA ttaagaaata G - C C - G G - C C - G C - G C - G G - C T A T C G T G C A C G A G | | | | | G T C T C G G C A C G C G | | | | T T G G A G C A T A A AGGTC T - A T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |