Sequence ID | >WENV180043526 |
Genome ID | LQAI01000290 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 285 |
End posion on genome | 210 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cggcaaaaaa |
tRNA gene sequence |
GCTGACGTAGCTCAATCGGTAGAGCGCATCCTTGGTAAGGATGAGGTAGGCAGTTCAATC |
Downstream region at tRNA end position |
tatatcaaag |
Secondary structure (Cloverleaf model) | >WENV180043526 Thr GGT a TCCA tatatcaaag G - C C - G T - A G - C A - T C - G G - C C T T T C G T C A T A A A + | | | | A C C T C G G G C A G C G | | | | T T G G A G C T A G AGGTA C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |