Sequence ID | >WENV180043535 |
Genome ID | LQAI01000466 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 7200 |
End posion on genome | 7115 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caggatataa |
tRNA gene sequence |
TGGTGGGGTTCCCGAGTGGCCAAAGGGAACAGACTGTAAATCTGTCGGCATACGCCTTCG |
Downstream region at tRNA end position |
aaattttata |
Secondary structure (Cloverleaf model) | >WENV180043535 Tyr GTA a CCAc aaattttata T - A G - C G - C T - A G - C G - C G - C T A G C C T C C A T G A G T | | | | | A G C C C T G G A G G C G | | + T T C A G G G C A A A CGGCATACGCCTTC A - T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |