Sequence ID | >WENV180043536 |
Genome ID | LQAI01000466 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 7046 |
End posion on genome | 6971 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaaaagtga |
tRNA gene sequence |
GCGGGAATAGCTCAATTGGTAGAGCATCAGCCTTCCAAGCTGAGGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
tgttctgctt |
Secondary structure (Cloverleaf model) | >WENV180043536 Gly TCC a TCCA tgttctgctt G - C C - G G - C G - C G - C A - T A - T T G T T G C C C A T A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |