Sequence ID | >WENV180043620 |
Genome ID | LQAI01002715 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1206 |
End posion on genome | 1130 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
caaacaccgt |
tRNA gene sequence |
CGGGGTGTAGCGCAGTTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
atttacttaa |
Secondary structure (Cloverleaf model) | >WENV180043620 Pro TGG t ACCA atttacttaa C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A T G A A | | + | | A T C G C G G C G G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |