Sequence ID | >WENV180043640 |
Genome ID | LQAI01004159 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 718 |
End posion on genome | 642 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tagcccgagt |
tRNA gene sequence |
GCGCCAGTAGCTCAGTTGGATAGAGCATCGGCCTTCTAAGCCGACGGCCGGGGGTTCGAA |
Downstream region at tRNA end position |
catatttcaa |
Secondary structure (Cloverleaf model) | >WENV180043640 Arg TCT t ACCA catatttcaa G - C C - G G - C C - G C - G A - T G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A CGGCC T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |