Sequence ID | >WENV180043660 |
Genome ID | LQAI01005069 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1205 |
End posion on genome | 1123 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tgaaaatcaa |
tRNA gene sequence |
GGGGAGATACCGAAGCGGTCAAACGGGGCAGACTGTAAATCTGTTGGCTCAGCCTTCGGA |
Downstream region at tRNA end position |
taaaaagcgg |
Secondary structure (Cloverleaf model) | >WENV180043660 Tyr GTA a ACgt taaaaagcgg G - C G - C G - C G - C A - T G - C A - T T A T C C T C C A C G A A | | | | | G G A G C C G G A G G C G | | | T T T A C G G C A A G TGGCTCAGCCTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |