Sequence ID | >WENV180043681 |
Genome ID | LQAI01006992 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 485 |
End posion on genome | 411 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ctcaaaaaat |
tRNA gene sequence |
GTCGGTAACGCATAAATGGTGGTGCGCCAGCCTTCCAAGCTGGAATAGAGACGGTTCGAT |
Downstream region at tRNA end position |
agaatactaa |
Secondary structure (Cloverleaf model) | >WENV180043681 Gly TCC t TCaa agaatactaa G - C T - A C - G G - C G - C T - A A - T C T A T T G C C A A A A C + | | | | G T T A C G G A C G G C G + | | | T T G G T G C T G G AATAGA C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |