Sequence ID | >WENV180043773 |
Genome ID | LQAI01018015 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 318 |
End posion on genome | 392 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcattaactt |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
gaaaatctgc |
Secondary structure (Cloverleaf model) | >WENV180043773 Gly GCC t TCCA gaaaatctgc G - C C - G G - C G - C A - T A - T G - C T A T T G C T C A G A G + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |