Sequence ID | >WENV180043844 |
Genome ID | LQAJ01000006 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 238988 |
End posion on genome | 238913 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gattttccaa |
tRNA gene sequence |
GCGCCCGTAGTCCAGTGGATAAGACGTCAGCCTCCGAAGCTGAAAATCGCTGGTTCGATT |
Downstream region at tRNA end position |
acccttccct |
Secondary structure (Cloverleaf model) | >WENV180043844 Arg CCG a ACCA acccttccct G - C C - G G - C C - G C - G C - G G - C T T T C G A C C A T G A A | | | | | G G C C T G G C T G G C G | | | T T A A G A C T A G AAATC T - A C - G A - T G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |