Sequence ID | >WENV180043845 |
Genome ID | LQAJ01000006 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 213066 |
End posion on genome | 212993 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tccatacaga |
tRNA gene sequence |
TGGGTGATCGTCCAATGGCAGGACTACGGACTCTGACTCCGTCAATCTAGGTTCGAATCC |
Downstream region at tRNA end position |
aaaatatcaa |
Secondary structure (Cloverleaf model) | >WENV180043845 Gln CTG a GCCA aaaatatcaa T - A G - C G - C G - C T - A G - C A - T T A T G A T C C A A A C | | | | | G T C C T G C T A G G C G | | | | T T G G G A C C A T CAAT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |