Sequence ID | >WENV180043885 |
Genome ID | LQAJ01000044 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 90232 |
End posion on genome | 90306 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttgtgattga |
tRNA gene sequence |
GCGGGAATAACTCAGTGGTAGAGTGCGACCTTGCCAAGGTCGAAGTCGCGGGTTCAAATC |
Downstream region at tRNA end position |
ttcaaggcgg |
Secondary structure (Cloverleaf model) | >WENV180043885 Gly GCC a TCCA ttcaaggcgg G - C C - G G - C G - C G - C A - T A - T T A T T G C C C A G A A + | | | | A T C T C A G C G G G C G | | | | T T G G A G T T A G AAGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |