Sequence ID | >WENV180043911 |
Genome ID | LQAJ01000066 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 63990 |
End posion on genome | 63915 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
taaccgacat |
tRNA gene sequence |
GACCCATTAGCTCAGTCGGTAGAGCACCTGACTTTTAATCAGGGTGTCCTGCGTTCGAGT |
Downstream region at tRNA end position |
ataaaacgct |
Secondary structure (Cloverleaf model) | >WENV180043911 Lys TTT t ACCA ataaaacgct G - C A - T C - G C - G C - G A - T T - A T G T G A C G C A T G A A | | | | | G C C T C G C T G C G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |