Sequence ID | >WENV180043920 |
Genome ID | LQAJ01000073 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 20186 |
End posion on genome | 20260 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gaagccatac |
tRNA gene sequence |
TGGGGCGTCGTCAAGTGGCAAGACACAGGGTTTTGATCCCTGCATTCAGAGGTTCGAATC |
Downstream region at tRNA end position |
tttttggatg |
Secondary structure (Cloverleaf model) | >WENV180043920 Gln TTG c GCCA tttttggatg T - A G - C G - C G - C G - C C - G G - C T A T T C T C C A G A C | | | | | G T A C T G A G A G G C G | | | T T G A G A C C A A CATTC C - G A - T G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |