Sequence ID | >WENV180043926 |
Genome ID | LQAJ01000079 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1919 |
End posion on genome | 2005 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cgtctcccgt |
tRNA gene sequence |
GCCAGGGTGGCGGAATTGGTAGACGCAGCGGATTCAAAATCCGCCGGCTTCACGGCCGTC |
Downstream region at tRNA end position |
gaatgaaatt |
Secondary structure (Cloverleaf model) | >WENV180043926 Leu CAA t ACCA gaatgaaatt G + T C - G C - G A - T G + T G - C G - C T G T G C C C C A T A A G | | | | | A T G G C G C G G G G C G | | | T T G A C G C T A G A CGGCTTCACGGCCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |