Sequence ID | >WENV180043941 |
Genome ID | LQAJ01000083 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 59209 |
End posion on genome | 59134 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tttgtttttc |
tRNA gene sequence |
GGGCGATTAACTCAGTTGGGAGAGTGCAACCCTTACAAGGTTGAAGTCGCAGGTTCAAGC |
Downstream region at tRNA end position |
ggtgacactg |
Secondary structure (Cloverleaf model) | >WENV180043941 Val TAC c ACCA ggtgacactg G - C G - C G - C C - G G - C A - T T - A C G T C G T C C A T G A A | | | | | A T C T C A G C A G G C G | | | | T T G G A G T G A G AAGTC C - G A - T A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |