Sequence ID | >WENV180043965 |
Genome ID | LQAJ01000132 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 26891 |
End posion on genome | 26966 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tcgtttccaa |
tRNA gene sequence |
GCGGGTGTAACTCAATTGGTAGAGTGTCAGCTTCCCAAGCTGAAAGTAGCGGGTTCGACC |
Downstream region at tRNA end position |
ttgcctttcg |
Secondary structure (Cloverleaf model) | >WENV180043965 Gly CCC a TCCA ttgcctttcg G - C C - G G - C G - C G - C T - A G - C C C T T G C C C A T A A A + | | | | G T C T C A G C G G G C G | | | | T T G G A G T T A G AAGTA T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |