Sequence ID | >WENV180044003 |
Genome ID | LQAJ01000200 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 8709 |
End posion on genome | 8634 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ctcttcctgc |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGGAGAGCATCGCCCTTACAAGGCGAGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
tctttgaaat |
Secondary structure (Cloverleaf model) | >WENV180044003 Val TAC c ACCA tctttgaaat G - C G - C G - C C - G G - C C - G T - A C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |