Sequence ID | >WENV180044018 |
Genome ID | LQAJ01000318 |
Search identical group | |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 12069 |
End posion on genome | 12153 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
caaaaataag |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGTCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGGA |
Downstream region at tRNA end position |
taaatgtagg |
Secondary structure (Cloverleaf model) | >WENV180044018 Tyr GTA g ACCA taaatgtagg G - C G - C T - A G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T T A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |