Sequence ID | >WENV180044032 |
Genome ID | LQAJ01000450 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 7848 |
End posion on genome | 7773 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cggcaagcat |
tRNA gene sequence |
TCCCCAGTGGCTCAATTGGCAGAGCGGGTGACTGTTAATCACTAGGTTCGCGGTTCAAGT |
Downstream region at tRNA end position |
agagaatcaa |
Secondary structure (Cloverleaf model) | >WENV180044032 Asn GTT t GCCA agagaatcaa T - A C - G C - G C - G C - G A - T G - C T G T G T G C C A T A A G | + | | | A T C T C G C G C G G C G | | | | T T G G A G C C A G AGGTT G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |