Sequence ID | >WENV180044048 |
Genome ID | LQAJ01000616 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2039 |
End posion on genome | 2114 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ctcccgtttc |
tRNA gene sequence |
GCCAGAATAGCTCAGTTGGTAGAGCAACTGATTCGTAATCAGTAGGTCGTCGGTTCAACT |
Downstream region at tRNA end position |
aggaaaatca |
Secondary structure (Cloverleaf model) | >WENV180044048 Thr CGT c TCCA aggaaaatca G - C C - G C - G A - T G - C A - T A - T T C T T A G C C A T G A A + | | | | A T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |