Sequence ID | >WENV180044083 |
Genome ID | LQAJ01002277 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 792 |
End posion on genome | 866 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
aagtttacat |
tRNA gene sequence |
GGTCCCATCGTCTAGCGGTTAGGACGCTGGCCTCTCACGCCGGAAACCGGGGTTCGATTC |
Downstream region at tRNA end position |
ctgaaaataa |
Secondary structure (Cloverleaf model) | >WENV180044083 Glu CTC t ACCA ctgaaaataa G - C G + T T - A C - G C - G C - G A - T T T T G C C C C A C G A C | | | | | G G T C T G C G G G G C G + | | | T T T G G A C T A G AAAC C - G T + G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |