Sequence ID | >WENV180044085 |
Genome ID | LQAJ01002296 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1063 |
End posion on genome | 989 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgctccacca |
tRNA gene sequence |
GGCGGCTTGGCCAAGTGGTAAGGCGACGGCCTGCAAAGCCGTTATTCTCCAGTTCAAATC |
Downstream region at tRNA end position |
acccagactt |
Secondary structure (Cloverleaf model) | >WENV180044085 Cys GCA a TCCA acccagactt G - C G - C C - G G - C G - C C - G T - A T A T A G G T C A G A G | | | | | A T A C C G T C C A G C G | | | T T G A G G C T A G TATTC A - T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |