Sequence ID | >WENV180044087 |
Genome ID | LQAJ01002646 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 91 |
End posion on genome | 166 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
catttttttt |
tRNA gene sequence |
AGGCCAGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
atttaacgct |
Secondary structure (Cloverleaf model) | >WENV180044087 Trp CCA t GCCA atttaacgct A - T G - C G - C C - G C - G A - T G - C T G T C T C C C A T A A G | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |