Sequence ID | >WENV180044090 |
Genome ID | LQAJ01002758 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 601 |
End posion on genome | 676 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tatttccgtT |
tRNA gene sequence |
GGGCGGGTAGCTCAGTTGGTTAGAGCGCATCTCTTACACAGATGAGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
taccttctta |
Secondary structure (Cloverleaf model) | >WENV180044090 Val TAC T ATta taccttctta G - C G - C G - C C - G G - C G - C G + T C G T T G T C C A T G A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A C - G T - A C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |