Sequence ID | >WENV180044092 |
Genome ID | LQAJ01003066 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 5 |
End posion on genome | 81 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnnnnnttgc |
tRNA gene sequence |
AGGTCAGTAGCTCCAATTGGCAGAGCTCCGGACTCCAAATCCGGCTGTTGGGGGTTCGAC |
Downstream region at tRNA end position |
cttttttggc |
Secondary structure (Cloverleaf model) | >WENV180044092 Trp CCA c GCCA cttttttggc A - T G - C G - C T - A C - G A - T G - C T C T C T C C C A A A C A | + | | | G T C T C G G G G G G C T | | | | T T G G A G C G C A T CTGTT C - G C - G G - C G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |