Sequence ID | >WENV180044099 |
Genome ID | LQAJ01004669 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 665 |
End posion on genome | 589 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aaataattac |
tRNA gene sequence |
GGGGGTGTAGTTCAGTTGGTTAGAACGCTAGCCTGTCACGCTAGAGGCCGCGAGTTCGAG |
Downstream region at tRNA end position |
caatataaaa |
Secondary structure (Cloverleaf model) | >WENV180044099 Asp GTC c GCCA caatataaaa G - C G - C G - C G + T G - C T - A G - C T G T T G C T C A T G A A + | | | | G T C T T G G C G A G C G | | | | T T G G A A C T T A G AGGCC C - G T - A A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |