Sequence ID | >WENV180044145 |
Genome ID | LQAJ01007795 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 347 |
End posion on genome | 271 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cattttttaa |
tRNA gene sequence |
GCCCATGTAGCTCAGTCGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTTCACCAGTTCGAT |
Downstream region at tRNA end position |
aattatgcta |
Secondary structure (Cloverleaf model) | >WENV180044145 Thr GGT a TCCA aattatgcta G - C C - G C - G C - G A - T T - A G - C T T T T G G T C A T G A A | | | | | G C C T C G A C C A G C G | | | | T T G G A G C T A G AGGTTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |