Sequence ID | >WENV180044149 |
Genome ID | LQAJ01008698 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 608 |
End posion on genome | 682 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ttttataatc |
tRNA gene sequence |
TGGGGTATCGCCAAGTGGTAAGGCAACGGCTTTTGGTGCCGTCATTCGAAGGTTCGAATC |
Downstream region at tRNA end position |
caaacttttt |
Secondary structure (Cloverleaf model) | >WENV180044149 Gln TTG c TCCA caaacttttt T - A G - C G - C G - C G - C T - A A - T T A T C T T C C A G A C | | | | | G T A C C G G A A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C C - G T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |