Sequence ID | >WENV180044154 |
Genome ID | LQAJ01009876 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 53 |
End posion on genome | 129 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aaagaaatga |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGTGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tatacagaaa |
Secondary structure (Cloverleaf model) | >WENV180044154 Arg ACG a GCCA tatacagaaa G - C C - G G - C C - G C - G C - G G - C T A T C T T C C A C G A A | + | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A TGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |