Sequence ID | >WENV180044173 |
Genome ID | LQAJ01015423 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 531 |
End posion on genome | 454 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tcaagttatT |
tRNA gene sequence |
GGGGCTGTAGCTCAGATGGGAGAGCGCATGACTGGCAGTCATGAGGTCAGGGGTTCGATC |
Downstream region at tRNA end position |
Acgcaaacaa |
Secondary structure (Cloverleaf model) | >WENV180044173 Ala GGC T ACCC Acgcaaacaa G - C G - C G + T G - C C - G T - A G - C C T T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G A - T T - A G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |