Sequence ID | >WENV180044195 |
Genome ID | LQAJ01020313 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 6 |
End posion on genome | 81 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnnaatag |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGGAGAGCGCCTGCCTTACAAGCAGGTGGTCGGGGGTTCAAGT |
Downstream region at tRNA end position |
tttgccgact |
Secondary structure (Cloverleaf model) | >WENV180044195 Val TAC g ACCA tttgccgact G - C G - C G - C C - G G - C C - G T - A T G T C T C C C A T G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C G A G TGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |