Sequence ID | >WENV180046955 |
Genome ID | MPLT02158299 |
Search identical group | |
Phylum/Class | [MPLT] marine metagenome; 70 m water sample filtered on 0.2 um supor filter |
Species | |
Start position on genome | 1364 |
End posion on genome | 1447 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttttatataT |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCGAGTTTTAGGTACTCGTATCTTCGGGTGTGGG |
Downstream region at tRNA end position |
aagggaactc |
Secondary structure (Cloverleaf model) | >WENV180046955 Leu TAG T ATtt aagggaactc G - C C - G G - C G - C T - A C - G G - C T G T C C C T C A T A A G | | | | | A T G G C G G G G A G C G | | | T T G A C G C T A G G TATCTTCGGGTGT C - G G - C A - T G - C T - A T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |