Sequence ID | >WENV180049059 |
Genome ID | MPLU02031268 |
Search identical group | |
Phylum/Class | [MPLU] marine metagenome; 90 m water sample filtered on 0.2 um supor filter |
Species | |
Start position on genome | 2942 |
End posion on genome | 3017 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cactcggcat |
tRNA gene sequence |
AGGGGTTTAGCTCAGTTGGTAGAGCATCGGTCTCCAAAACCGAGGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
gtctcaacac |
Secondary structure (Cloverleaf model) | >WENV180049059 Trp CCA t GCCA gtctcaacac A - T G - C G - C G - C G - C T + G T - A T G T C T C C C A T G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |