Sequence ID | >WENV180049230 |
Genome ID | MPLU02044871 |
Search identical group | |
Phylum/Class | [MPLU] marine metagenome; 90 m water sample filtered on 0.2 um supor filter |
Species | |
Start position on genome | 430 |
End posion on genome | 505 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaaagcgtgt |
tRNA gene sequence |
TGGGGTATCGCCAAGTTGGTAAGGCAACGGGTTTTGATCCCGTCATTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
ttttctttcc |
Secondary structure (Cloverleaf model) | >WENV180049230 Gln TTG t GCCA ttttctttcc T - A G - C G - C G - C G - C T - A A - T T G T C G T C C A T G A C | + | | | G T A C C G G T A G G C G | | | T T G A G G C T A A CATTC A - T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |