| Sequence ID | >WENV180052267 |
| Genome ID | MPLU02282748 |
| Phylum/Class | [MPLU] marine metagenome; 90 m water sample filtered on 0.2 um supor filter |
| Species | |
| Start position on genome | 1045 |
| End posion on genome | 1118 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
tcttctctta |
| tRNA gene sequence |
GGCTGGGTGGCAGAGTGGTTATGCAGCGGCCTGCAAAGCCGTGGACGCCGGTTCGATTCC |
| Downstream region at tRNA end position |
attacccttg |
| Secondary structure (Cloverleaf model) | >WENV180052267 Cys GCA
a TCCA attacccttg
G - C
G - C
C - G
T - A
G - C
G - C
G - C T T
T C A G C C A
G A G | | | | G
T G A C G G C C G G C
G | | | T T
G A T G C
T T A GGAC
G + T
C - G
G - C
G - C
C - G
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |