| Sequence ID | >WENV180057992 |
| Genome ID | MPLX02030921 |
| Phylum/Class | [MPLX] marine metagenome; 120 m water sample filtered on 0.2 um supor filter |
| Species | |
| Start position on genome | 77 |
| End posion on genome | 4 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
tatcatttta |
| tRNA gene sequence |
GGGCCCGTAACTCAGCTTGGTAGAGTAACCGGCTCATAACCGGTGAGCCAAGGGATCGAA |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV180057992 Met CAT
a Attt nnnnnnnnnn
G - C
G - C
G - C
C - G
C - G
C - G
G - C G A
T T T C C C A
C G A A | | | | | G
T C T C A A A G G G C
T | | | | A T
G G A G T
G T A A GAGCC
A - T
C - G
C - G
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |