Sequence ID | >WENV180058031 |
Genome ID | MPLX02032535 |
Search identical group | |
Phylum/Class | [MPLX] marine metagenome; 120 m water sample filtered on 0.2 um supor filter |
Species | |
Start position on genome | 540 |
End posion on genome | 467 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gctccgactt |
tRNA gene sequence |
GCCGGTGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
ttagcgccga |
Secondary structure (Cloverleaf model) | >WENV180058031 Thr TGT t TCat ttagcgccga G - C C - G C - G G - C G - C T + G G - C T A T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |