Sequence ID | >W141004894 |
Genome ID | AFYT01000017 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Lacticaseibacillus paracasei Lc-10 [AFYT] |
Start position on genome | 89215 |
End posion on genome | 89288 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttaggtactT |
tRNA gene sequence |
GCGCGGTTAGTGTAATGGATCGCACGTGAGATTCCGGTTCTCGAAATCCGGGTTCGACTC |
Downstream region at tRNA end position |
acccggttaa |
Secondary structure (Cloverleaf model) | >W141004894 Arg CCG T AGaa acccggttaa G - C C - G G - C C - G G + T G - C T + G T C T G G C C C A T A A A | | | | | G G T G T G C C G G G C G + | | | T T A G C A C T C G AAAT T + G G - C A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |