Sequence ID | >WENV180070152 |
Genome ID | MPLZ02152055 |
Search identical group | |
Phylum/Class | [MPLZ] marine metagenome; 160 m water sample filtered on 0.2 um supor filter |
Species | |
Start position on genome | 670 |
End posion on genome | 597 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
taaaacctct |
tRNA gene sequence |
GGCTGGGTAGCAAAGCGGTTATGCAGGGGCCTGCAAAGCCTTATAGACCGGTTCGACTCC |
Downstream region at tRNA end position |
tcattaaaaa |
Secondary structure (Cloverleaf model) | >WENV180070152 Cys GCA t TCCA tcattaaaaa G - C G - C C - G T - A G - C G - C G - C T C T T G G C C A G A A | | | | | G C A A C G A C C G G C G | | | T T G A T G C T T A ATAG G + T G + T G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |