| Sequence ID | >WENV180073749 |
| Genome ID | MPMA02098070 |
| Phylum/Class | [MPMA] marine metagenome; 180 m water sample filtered on 0.2 um supor filter |
| Species | |
| Start position on genome | 19 |
| End posion on genome | 95 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
gtacatcact |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
tttattgatt |
| Secondary structure (Cloverleaf model) | >WENV180073749 Pro TGG
t ACCA tttattgatt
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C G T C C A
C G A A | | | | | A
C C G C G G C A G G C
T | | | | T T
G G C G C
G T A A GGGTC
T - A
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |